TOMATOMICS

tomatomics  The Tomato Integrated Database

BLAST Search for KTU4 or ESTs
Input query sequence(s) (in multi-FASTA format).
Upload a file : 
Program Database E-value
Filter MAX. number of hits (-b)
*The subject database of this BLAST program is comprised of KTU4 (58,083) and EST (278,969) sequences.
How to input your query sequences.
IT IS IMPORTANT to have a header which starts with ">" symbol before each of your query sequence.
Example
Type ">" and an arbitrary identifier name in the first line. No space between ">" and the first letter of the identifier. From the second line, type or paste your query sequence.
>test
TGTTTATAGATCAAAAGGCTCTCTCT
TCAATTCTTCTTTCATTTCCAGATCC
CTCTAAGTATCGCCCATCAAGCG